EST details — SGN-C14296

Search information 
Request: 14296Match: SGN-C14296
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14296Clone name: cLEC-7-H19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172925 is on microarray TOM1: SGN-S1-1-6.1.20.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172925 [TUS-14-M19] Trace: SGN-T195149 EST: SGN-E393823 Direction: 3' Facility: INRA
Clone: SGN-C172925 [TUS-14-M19] Trace: SGN-T195324 EST: SGN-E393998 Direction: 5' Facility: INRA
Clone: SGN-C172925 [TUS-14-M19] Trace: SGN-T195602 EST: SGN-E394276 Direction: 3' Facility: INRA
Clone: SGN-C172925 [TUS-14-M19] Trace: SGN-T195602 EST: SGN-E398983 Direction: 3' Facility: INRA
Clone: SGN-C172925 [TUS-14-M19] Trace: SGN-T195603 EST: SGN-E394277 Direction: 5' Facility: INRA
Clone: SGN-C172925 [TUS-14-M19] Trace: SGN-T195603 EST: SGN-E398984 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202177Length: 462 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202177 [] (trimmed) AATATCCTTTGCTCATTTCAGTTCCAAAAACTCGAAGAAGAAGAAGAAGAGATCAATGGAAGGTTTCACATCGTTCTTCGACTCGCAATCTGCCT
CTCGCAACCGCTGGAGTTATGATTCTCTCAAAAACTTCCGCCAGATCTCACCTCTCGTTCAAACTCATCTCAAGCAGGTGTACCTTACGCTATGC
TGTGCTTTAGTGGCATCGGCTGCTGGGGCTTACCTTCACATTCTATGGAATATCGGTGGCCTCCTCACAACAATGGCTTGCATGGGAAGCATGGT
GTGGCTTCTCTCAGCTCCTCCTTATCAAGAGCAAAAAAGGGTGGCTCTTCTGATGGCAGCTGCACTTTTTGAAGGCGCCTCTATTGGTCCTCTGA
TTGAGCTGGGCATTAACTTCGATCCAAGCATTGTGTTTGGCGCTTTTGTAGGTTGGGCTGTGGTTATTGGTTGCTTCTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202177] SGN-U585582 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25459 [Download][View] Facility Assigned ID: TCABA46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5