EST details — SGN-C14310

Search information 
Request: 14310Match: SGN-C14310
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14310Clone name: cLEC-7-I14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172933 is on microarray TOM1: SGN-S1-1-6.2.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202146Length: 355 bp (745 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202146 [] (trimmed) CAGGTAGCGTTCAAGATGAGTTACAACAACGATCCGTACATAGATGAGGATGGAGAGGCATTGGTGGATTTTGATGAGGATGTCCGATCAGATAA
CGAGCAACAGGAACAATTTCTTGGTGACAATCTGGACGATGATGATGCATGGAATCAGAGACAGCGAGAGCGGTCACCGACCCCAGTATATGATG
ATCTTAACAAGTCTAAGCCCAGGAAGCGGTTAATTAAGAAATCTTCAGCTAGAGAAAACACACCGGATATTGGGCTAGGAGATGAGGAGGATGCT
TATGGTGGTGCTGCTGCTGATGACATGACTGGCAATATGCATGATGAGTTTGACGGCGGGGGTCCTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202146] SGN-U583807 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25428 [Download][View] Facility Assigned ID: TCAAZ55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5