EST details — SGN-C14389

Search information 
Request: 14389Match: SGN-C14389
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14389Clone name: cLEC-7-M11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172971 is on microarray TOM1: SGN-S1-1-8.3.20.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172971 [TUS-14-O17] Trace: SGN-T195329 EST: SGN-E394003 Direction: 5' Facility: INRA
Clone: SGN-C172971 [TUS-14-O17] Trace: SGN-T195611 EST: SGN-E394285 Direction: 5' Facility: INRA
Clone: SGN-C172971 [TUS-14-O17] Trace: SGN-T195611 EST: SGN-E398998 Direction: 5' Facility: INRA
Clone: SGN-C172971 [TUS-14-O17] Trace: SGN-T199614 EST: SGN-E398288 Direction: 3' Facility: INRA
Clone: SGN-C172971 [TUS-14-O17] Trace: SGN-T200198 EST: SGN-E398997 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201943Length: 545 bp (710 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201943 [] (trimmed) CAATTCTAGGGTTTCTAATTTTCTCTCTCTCTCTAAAAAAAAACTCTACTAATTGGTAGCATGCTTTAACAAGAATCAAGTAATAACATAGCTTG
AAAGACTTTGCAACTACCAAAAGGAAAATTTAAGGTATCTTTTTATTATATTTTCTTCAATTTTTTTTTTTATATATATAGGGCTAAGAGACCTA
TAAAAATCCCTACAATCTGTTAGTAAGTTAGTTGATTTTTTTGACAATAATATGAAAATTACTGTGACTTTTTATTAGTTGATGTGAGAAAAAAA
TGAAAGAAAAGACATGTTTTGCGGAAGTTTGCAGGTGGAATGTCGGATATTTACTTTAAAAAGGCAGCATAGTAAGTTTACCATATGTTTTACTG
TTTTGCTCCAAAATTAAATTTAAACTATATCAAATTTATATAGTGTGTGTTTTTAGTAAATTGACAAATCAACATTACTGAGCATGATATTTTTT
TTAAAATGTTTCCTTTTATTATAATTTCAAAATAAGAGGCCGTTTTGATTAGACTGATATATAGTAAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201943] SGN-U585494 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25225 [Download][View] Facility Assigned ID: TCAAY78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.897 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5