EST details — SGN-C14718

Search information 
Request: 14718Match: SGN-C14718
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14718Clone name: cLEC-8-E2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183625 is on microarray TOM1: SGN-S1-1-2.3.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183625 [TUS-42-K15] Trace: SGN-T194953 EST: SGN-E393627 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200074Length: 437 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200074 [] (trimmed) GGCAAACGAAGAGACTGAAGATCTTGTGAATATAGATGAGAAACCTCCTCCATTGGCCGGAACAAATGTTATGAACATTATTTTGGTGGCTTCAG
AATGCGCTCCATGGTCTAAAACAGGTGGGCTTGGAGATGTTGCTGGAGCATTACCGAAAGCTTTGGCTCGACGTGGCCACAGAGTTATGGTTGTG
GCACCTCGTTATGACAACTATCCTGAACCTCAAGATTCTGGTGTAAGAAAAATTTATAAAGTTCATGGTCAGGATGTAGAAGTGACTTACTTCCA
AGCTTTTATTGATGGTGTGGATTTTGTTTTCATTGACAGCCATATGTTTAGACACATTGGGAACAACATTTACGGAGGGAACCGTGTGGATATTT
TAAAGCGCATGGTTTTATTTTGCAAAGCAGCGATTGAGGTTCCTTGGCATGTTCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200074] SGN-U567954 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25163 [Download][View] Facility Assigned ID: TCABD25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5