EST details — SGN-C16768

Search information 
Request: 16768Match: SGN-C16768
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C16768Clone name: cLED-17-I19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175781 is on microarray TOM1: SGN-S1-1-6.4.11.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175781 [TUS-22-D19] Trace: SGN-T180684 EST: SGN-E367935 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238316Length: 429 bp (1238 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238316 [] (trimmed) CAGTAATTGTGATGAAGGATTAGTATGCTCTACTTGTTCTGCTAATGGCAATACCCGACCCAGATGTACTCGCATTCAACCCACTATTCCTACCA
CCAAGGTAAAAGGTTTGCCATTCAACAAGTATTCGTGGCTGACGACCCACAACTCCTTTGCAATTTCCGGGTCAACATCTGCAACTGGGTCTGAT
ATTCTTGCTCCGACCAACCAGGAAGATTCCATTACTAATCAGCTCAAGAATGGCGTTCGAGGACTTATGCTTGATATGTATGATTTCAACAATGA
CATCTGGCTTTGTCACTCATTTGGTGGGAAGTGTTACAATGTTACATCATTTCAACCTGCAATCAATTCACTGAAAGAAATTCAAGGGTTCCTCG
AAAAGAACCCATCAGAGGTCGTCACAATCTTCATTGAAGACTATGTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238316] SGN-U575440 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52758 [Download][View] Facility Assigned ID: TOVCM58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0170 Quality Trim Threshold: 14.5