Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E171910

Search information 
Request: 171910Match: SGN-E171910
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C112661Clone name: cTOA-17-N2
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C112661 [cTOA-17-N2] Trace: SGN-T126414 EST: SGN-E313800 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E171910Length: 227 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E171910 [] (called/trimmed by facility)
ATGACACTCAAAGGTTGGATAATTCCATCCAATGTCCCTCTTTTGCTAGCAACCACCATTGATTATTAAATTCAATTAATTTGCTGTTTAGGAAT
ATTGAAATAAATAATTAGGAAAATGGAAAGATTTTTTTTTTAATTAACTGCCTATAATTAAAAAAAGTAAATTACACAAAGCAGTAAGCAACTAA
GCACTGCTTACAGCCTTGCACCAAAAAAACACAACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T126414 [Download][View] Facility Assigned ID: TFACP73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence