EST details — SGN-C17218

Search information 
Request: 17218Match: SGN-C17218
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17218Clone name: cLED-19-A17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175851 is on microarray TOM1: SGN-S1-1-8.3.11.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237441Length: 307 bp (834 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237441 [] (trimmed) GAAATGAGACACGTGGCTTTCTCTCTTTGGTACTTGTCTTTACCAACATCGAAATATGCATACCATTTAAAATACAATCTACTGTGATACAAAAT
TAGTCACAAGGCGTAAGACCTTGCAGCAAAATAACAAGTATACTTCTACACAAGGTTTTTTACCATGTAAGGACCTTCAAGCTCATAGCCTAGCT
TTCTGTAGTAATGCCGGGTCCCTACACCCGATATAACAGCGATTTTGGTCGACCTATGCTCCCTCCGAGCAATCCGCTCAGCCTCCTCCATCAGC
AGAGTGCCATAACCCTGGTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237441] SGN-U565898 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53355 [Download][View] Facility Assigned ID: TOVCU09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0182 Quality Trim Threshold: 12.5