Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C17233

Search information 
Request: 17233Match: SGN-C17233
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17233Clone name: cLED-19-B10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175859 is on microarray TOM1: SGN-S1-1-8.4.11.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175859 [TUS-22-H1] Trace: SGN-T180689 EST: SGN-E367940 Direction: 3' Facility: INRA
Clone: SGN-C175859 [TUS-22-H1] Trace: SGN-T180690 EST: SGN-E367941 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237559Length: 434 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237559 [] (trimmed) CAGATGAGCTGCAAGACGCTCGCAAAGAATTGGTTAATGGTTTGAAGGAACTACCGAGAGTTGGTCCAATTGGTGTTAAGAGGATGGGGGAGCTT
GACAACAGACCATTCCATGAAGCAATGAAGAGGAACTATAATGAGTCAGAAGCAGATGAAAGAGCTACAGAGTTATGCTCATTGTGGGAGGAATA
CCTTAGAGACCCTGGATGGCATCCCATTAAAGTCGTTATGATTAACGGGAAACCTGAGAATGTTATAGACGAAGAAGATGAAAAGCTGAAAGACT
TGAAAAGAAATTATGGTGAAGAAGTTTGCAAAGCTGTGACAGCAGCTTTGATGGAGGTAAACGATTACAACCCGAGTGGAAGATACATCATCTCA
GAGCTGTGGAATTATGCGGTGAATAAGAAAGCCTCTTTGGAGGGAGGAGTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237559] SGN-U568028 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53473 [Download][View] Facility Assigned ID: TOVCX05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5