EST details — SGN-C172680

Search information 
Request: 172680Match: SGN-C172680
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172680Clone name: TUS-14-C14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172680 is on microarray TOM1 spot ID 1-1-3.3.20.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10796 [cLEC-6-E6] Trace: SGN-T24117 EST: SGN-E202456 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398290Length: 363 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E398290 [] (trimmed) GAAGAAATCATTGATTAGATTCGTTGTGTAGATTTTGGTTATCTGCAGTTTTTGTTTTTCATTTTAAATTTGTGAATCGAGAGTGTATACGAATT
TATTCAAGGAAAACACTTTTAGGAGCTTTTGTTGATCCTTCAATGGCCGCACCACCGGCGAGGGCTAGAGCAGACTATGATTATCTCATTAAGCT
TCTTTTGATCGGCGATAGTGGTGTTGGTAAGAGTTGTCTTCTTTTACGTTTCTCTGATGGTTCCTTCACCACAAGCTTCATCACAACTATCGGAA
TTGATTTTAAAATTCGAACCATTGAGCTTGATGGAAAAAGAATCGAGCTTCTTTTTTTTTATAGAGCTGGTCAGGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398290] SGN-U578498 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199616 [Download][View] Facility Assigned ID: FA0AAD2BB07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5