EST details — SGN-C172723

Search information 
Request: 172723Match: SGN-C172723
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172723Clone name: TUS-14-E9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172723 is on microarray TOM1 spot ID 1-1-8.1.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10854 [cLEC-6-H17] Trace: SGN-T23998 EST: SGN-E202337 Direction: 5' Facility: TIGR
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T195111 EST: SGN-E393785 Direction: 3' Facility: INRA
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T195743 EST: SGN-E394417 Direction: 3' Facility: INRA
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T195743 EST: SGN-E399519 Direction: 3' Facility: INRA
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T200172 EST: SGN-E398921 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393786Length: 381 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393786 [] (trimmed) GAAAGTGATATCGAAAATCTTCCTTATATGCAAGCTGTAATCAAAGAATCACTTCGTTTACATCCTCCTCTCCCTTTCTTGATCCCAAGAGAGAC
AATTCAAGACACTAAGTTCATGGGGTACGACGTGCTAAAAGGGACTCGAGTCCTCGTAAATGCCTGGGCAATTGGAAGAGATCCTGAATGTTGGG
ACGACCCTATGAGTTTCAAGCCCGAGAGGTTTCTTGGCTCGAAATTGGACGTGAAGGGTCAGCATTATGAGCTAATTCCATTTGGTGCAGGACGA
AGAATGTGTGTTGGTTTGCCTTTAGGCCATCGAATGATGCATTTCGCTCTTGGATCGTTGCTTCATGAATTCGATTGCGAGCTTCCAAATGGTGT
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393786] SGN-U580161 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195112 [Download][View] Facility Assigned ID: FA0AAD2AC05RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5