EST details — SGN-C172724

Search information 
Request: 172724Match: SGN-C172724
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172724Clone name: TUS-14-E10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172724 is on microarray TOM1 spot ID 1-1-7.1.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10855 [cLEC-6-H18] Trace: SGN-T24220 EST: SGN-E202559 Direction: 5' Facility: TIGR
Clone: SGN-C172724 [TUS-14-E10] Trace: SGN-T195372 EST: SGN-E394046 Direction: 3' Facility: INRA
Clone: SGN-C172724 [TUS-14-E10] Trace: SGN-T195372 EST: SGN-E399539 Direction: 3' Facility: INRA
Clone: SGN-C172724 [TUS-14-E10] Trace: SGN-T199452 EST: SGN-E398126 Direction: 3' Facility: INRA
Clone: SGN-C172724 [TUS-14-E10] Trace: SGN-T200209 EST: SGN-E399042 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394338Length: 296 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394338 [] (trimmed) ATCGTCAATAGTGTAAAATGATTTCTCAATAATGGAGAAATTGTTGAAACTGCGAGTTTTGCTTCTCCTTCTTCTTCTTCTTCAACAACAACAAG
AAGCTAATTCGTATTCTACTGTTGAGTATCTTCCCGGTTGGCAGGGCCGCCTCCCGTTTCCTCTAGAGACCGGGTATGTTGGAGTCGGTAAAGAT
GAAGCGGAGCAACTTTTCTACTAATTTTTGGAGTGAGAATCAAAGGCTACTACTGATCCTCTTTTGGTATGGATATCTGGTGGACGAAGGAGCAC
TACTGTGTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394338] SGN-U583065 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195664 [Download][View] Facility Assigned ID: FA0AAD2BC05RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5