EST details — SGN-C172803

Search information 
Request: 172803Match: SGN-C172803
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172803Clone name: TUS-14-H17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172803 is on microarray TOM1 spot ID 1-1-8.4.20.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10970 [cLEC-6-M2] Trace: SGN-T24142 EST: SGN-E202481 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394560Length: 83 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E394560 [] (trimmed - flagged) GCTGCAGGAATTCGGCACGAGATTTTTACACAACCATGTGTCCCATTCGTTTCAGATGATCGCATACTGCTCCGGAAAACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T195886 [Download][View] Facility Assigned ID: FA0AAD2CD09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.750 Expected Error Rate: 0.0455 Quality Trim Threshold: 14.5