EST details — SGN-C172803
| Search information |
| Request: 172803 | Match: SGN-C172803 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C172803 | Clone name: TUS-14-H17 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172803 is on microarray TOM1 spot ID 1-1-8.4.20.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C10970 [cLEC-6-M2] | Trace: SGN-T24142 | EST: SGN-E202481 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E394560 | Length: 83 bp (898 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E394560 [] (trimmed - flagged)
GCTGCAGGAATTCGGCACGAGATTTTTACACAACCATGTGTCCCATTCGTTTCAGATGATCGCATACTGCTCCGGAAAACCTG
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T195886 [Download][View] | Facility Assigned ID: FA0AAD2CD09RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.750 | Expected Error Rate: 0.0455 | Quality Trim Threshold: 14.5 |


