EST details — SGN-C172850
| Search information |
| Request: 172850 | Match: SGN-C172850 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C172850 | Clone name: TUS-14-J16 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172850 is on microarray TOM1 spot ID 1-1-1.2.20.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C11040 [cLEC-6-P4] | Trace: SGN-T24064 | EST: SGN-E202403 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C172850 [TUS-14-J16] | Trace: SGN-T188026 | EST: SGN-E374718 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E374719 | Length: 166 bp (926 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E374719 [] (trimmed)
TTGCTCTTGCTTATTATCTGTATAACAACTTTACATTTACCATCTTATATTCCGTACTATATTACTTGCTTTTTATTTCCCCTTACTCTTCCCTA
CCCCATACCTAAATACTGGTTGACATCACCTATACGGACTACAAACCGTGTGGTTGCCATTTTCTTCACCC
CCCCATACCTAAATACTGGTTGACATCACCTATACGGACTACAAACCGTGTGGTTGCCATTTTCTTCACCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E374719] | SGN-U603132 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T188027 [Download][View] | Facility Assigned ID: FA0AAD2DE08RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.899 | Expected Error Rate: 0.0549 | Quality Trim Threshold: 12.5 |


