EST details — SGN-C172850

Search information 
Request: 172850Match: SGN-C172850
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C172850Clone name: TUS-14-J16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172850 is on microarray TOM1 spot ID 1-1-1.2.20.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11040 [cLEC-6-P4] Trace: SGN-T24064 EST: SGN-E202403 Direction: 5' Facility: TIGR
Clone: SGN-C172850 [TUS-14-J16] Trace: SGN-T188026 EST: SGN-E374718 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374719Length: 166 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374719 [] (trimmed) TTGCTCTTGCTTATTATCTGTATAACAACTTTACATTTACCATCTTATATTCCGTACTATATTACTTGCTTTTTATTTCCCCTTACTCTTCCCTA
CCCCATACCTAAATACTGGTTGACATCACCTATACGGACTACAAACCGTGTGGTTGCCATTTTCTTCACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374719] SGN-U603132 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188027 [Download][View] Facility Assigned ID: FA0AAD2DE08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.899 Expected Error Rate: 0.0549 Quality Trim Threshold: 12.5