EST details — SGN-C177294

Search information 
Request: 177294Match: SGN-C177294
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177294Clone name: TUS-26-C20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177294 is on microarray TOM1 spot ID 1-1-5.3.6.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37100 [cLEG-41-A21] Trace: SGN-T72035 EST: SGN-E259003 Direction: 5' Facility: TIGR
Clone: SGN-C177294 [TUS-26-C20] Trace: SGN-T182409 EST: SGN-E368276 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368277Length: 412 bp (942 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368277 [] (trimmed) GTCGAGAATGTATGAAGATTGTGGAATGCCGTATATATTTTTGATGAATAATGTACATTACATCGTTCAGAAAGTGAAAGATTCAGAGCTTCAAA
AACTTTTAGGTGATCAGTGGGTCAGAAAGCGGAAGGGTCAGATTCGACAACATGCTACAAGCTATCTTAGAGCTTCATGGAGCAAGGTTTTATCT
TGTTTGAAAGATGAAGGGCTTAGCGGAAGCTCTAGCAATGCTTCAAAGGTAGCCCTCAAGGAGAGGTTTAAGAACTTCAACGCATGTTTCGAAGA
AATTTACAGAATCCAGACTGGTTGGAAGGTCCCAGATGCTCAACTGCGCGAAGAACTCAGGATTTCTATTTCTGAAAAGGTGCTTCCTGCATATC
GCTCATTTCTAGGAAGATTTGGGGGTTCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368277] SGN-U571388 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182410 [Download][View] Facility Assigned ID: FA0AAD14BB10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5