EST details — SGN-C177528

Search information 
Request: 177528Match: SGN-C177528
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177528Clone name: TUS-26-M14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177528 is on microarray TOM1 spot ID 1-1-3.1.6.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37624 [cLEG-42-K10] Trace: SGN-T72270 EST: SGN-E259509 Direction: 5' Facility: TIGR
Clone: SGN-C177528 [TUS-26-M14] Trace: SGN-T182376 EST: SGN-E368243 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368244Length: 476 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368244 [] (trimmed) CTCTCTAGTAATTTCATGTCTATTCAATTCCTTCAAAGGGTACTTTCCCTTTTAAGATCTTTTCATACACAATTAACACTTCTTGTTCAAAAACT
TCATTTGCCTGTTGGTGAAAAGTGGCTTGATGAGTATATGGATGAAAGTTCTAAGCTTTGGGAAGTTTGTCATGTTCTTAAGACTGGCATTTCTG
GATTAGAGAATTACTATTCTTCTGGTTTTAATGTCATTTCTTCTCTTGAGAATCATCAACATCTTAATCCACAATTATCTAGACAGGTGAGTAGA
GCAATAACAGGGTGTAGAAGAGAAGCAAATGGATTAGAGGAAGAAAACAGAGCATTAATGGAAACAAGAATTGAGCCACTCTCATTAAGATTTGA
TGAAATTGTTTTCAGTAGAATCAAAGCTAAATGGATTTAATGGATTCAGAGGAGTACTTTATGCAATGAGAAATGTTAGTTCAGTTTTGCTAATG
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368244] SGN-U568890 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182377 [Download][View] Facility Assigned ID: FA0AAD14BG07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5