EST details — SGN-C177748

Search information 
Request: 177748Match: SGN-C177748
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C177748Clone name: TUS-27-F18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177748 is on microarray TOM1 spot ID 1-1-7.2.6.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62063 [cLEM-1-F4] Trace: SGN-T83681 EST: SGN-E270308 Direction: 5' Facility: TIGR
Clone: SGN-C177748 [TUS-27-F18] Trace: SGN-T193265 EST: SGN-E391939 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391690Length: 208 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391690 [] (trimmed) TTTTTTTTCTTCACGCAATACATATGAACTGAAGAAAAAAATAAGAGAAAAAAAAAATCAATGGCGGCATCGAAGAGCTATTTCGCTAGATCGAA
CTACCGGTTTCTATCAAGTGACCGGAATGTTTCAGTAACTTCCGATACGATGTTCGAGCTGGATGAATCCGATGTATGGAACTCACCGGCGACGG
CAAGGTCATCGTCGCCGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391690] SGN-U576214 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193016 [Download][View] Facility Assigned ID: FA0AAD15DC09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5