EST details — SGN-C178048

Search information 
Request: 178048Match: SGN-C178048
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C178048Clone name: TUS-28-C6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178048 is on microarray TOM1 spot ID 1-1-3.3.4.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64464 [cLEM-6-D22] Trace: SGN-T84500 EST: SGN-E270744 Direction: 5' Facility: TIGR
Clone: SGN-C178048 [TUS-28-C6] Trace: SGN-T183404 EST: SGN-E370214 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370215Length: 208 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370215 [] (trimmed) CAAAGGCTCCCAGTTTGTATAAAGTTGTTCAGCCAGATGATGTCGTCAAGAAGACAGGATTAGCATTCCCGCACACTTGCTCACTGCCTTGCTTC
TGGTGAGATAATGTTGTCATTGTCTTCGAGATAAAGAAGGAAATGCTGAGGGGAATGGATTTCTTCTTCTTAATTCAGATTTCAACGTGAAGGGA
AGATGGGGAGAAACCAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370215] SGN-U573494 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183405 [Download][View] Facility Assigned ID: FA0AAD16BB03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.996 Expected Error Rate: 0.1358 Quality Trim Threshold: 14.5