EST details — SGN-C179147

Search information 
Request: 179147Match: SGN-C179147
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C179147Clone name: TUS-31-A1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179147 is on microarray TOM1 spot ID 1-1-8.1.2.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76493 [cLES-18-D17] Trace: SGN-T101729 EST: SGN-E289287 Direction: 5' Facility: TIGR
Clone: SGN-C179147 [TUS-31-A1] Trace: SGN-T184995 EST: SGN-E372538 Direction: 5' Facility: INRA
Clone: SGN-C179147 [TUS-31-A1] Trace: SGN-T185084 EST: SGN-E372627 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378397Length: 349 bp (1189 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378397 [] (trimmed) TTATGGGTGTTCAAAATCTGTAGATAGAAAGTCAAAATCATATACTTCCGATGCAAAATATGAAAAGAAACATATCATTTATTCTTAAGAGGAAC
ATTTGCTTCATGGAGTAGGTTTTTGTTTCAAATCCGAAAACCCTTCTCTTCTTTTATATCCCGGTAGCTCGATAGTATGCTTGATGAGAGCTCAG
TAGTTTTCTCTCGTCCATAAAAGAGTGCAAACCTGTTATGCAATAACCAATAGTCCAAAGATACTTGGTAATTGGGAACAAATGAGATACACTGG
ATTTACCAATAACTTGCCTGATCAGCAAAATAACAACTTCAAACTCCATGCAACTCAAAATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378397] SGN-U565094 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1523 [Download][View] Facility Assigned ID: TUS31A1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5