EST details — SGN-C179568

Search information 
Request: 179568Match: SGN-C179568
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C179568Clone name: TUS-32-B14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179568 is on microarray TOM1 spot ID 1-1-3.2.1.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82417 [cLET-1-N24] Trace: SGN-T102534 EST: SGN-E292260 Direction: 5' Facility: TIGR
Clone: SGN-C179568 [TUS-32-B14] Trace: SGN-T186283 EST: SGN-E372802 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372803Length: 219 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E372803 [] (trimmed) TTGAGTTGGAAGGATGTTCAATGGCTACAGTCAATTACTTCACTGCCAATCCTGGTAAAGGGTGTACTTACAGCTGAAGATGCTAAGATTGCAGT
TCAGTCTGGAGCAGCTGGTATCATTGTGTCGAACCACGGTGCTCGACAACTTGACTATGTCCCTGCCACAATTATGGCTCTTGAAGAGGTTGTGA
AAGCTGTACAAGGCCGTATCCCCGTGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372803] SGN-U579320 Tomato 200607 Build 2 210 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186284 [Download][View] Facility Assigned ID: FA0AAD20DA07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0000 Quality Trim Threshold: 14.5