EST details — SGN-C180390

Search information 
Request: 180390Match: SGN-C180390
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C180390Clone name: TUS-34-D20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180390 is on microarray TOM1 spot ID 1-1-5.4.19.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C33309 [cLEG-26-E4] Trace: SGN-T68195 EST: SGN-E253272 Direction: 5' Facility: TIGR
Clone: SGN-C180390 [TUS-34-D20] Trace: SGN-T187216 EST: SGN-E375448 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375449Length: 323 bp (949 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375449 [] (trimmed) TTTTATCTCAATTTCACTGGATTTCCTTTCCCTCTTGGCCCTTTCCTCAATAGACAAACCATTAGAACTGAGGCTGTGAAAGATACCATATGGTT
ATTTGAGCAAGAGCAAGCACTCGGATTCAGCAGTGTTTCAACAAACATCAGAATGACCGTCATCAAACTTAAATCTGGTGAATTGTGGGTTCATG
CTCCAATTGCTCCAACCAAAGAGTGTATTCAGCTCGTGAAAGAGTTAGGATGTCCTGTGAAATATATTGTCCTACCTACATTTGCATATGAGCAC
AAAATATTTGTTGTTCCATTTTCGAAAAAGTTCCAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375449] SGN-U585464 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187217 [Download][View] Facility Assigned ID: FA0AAD22DB10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5