EST details — SGN-C180703

Search information 
Request: 180703Match: SGN-C180703
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C180703Clone name: TUS-35-A21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180703 is on microarray TOM1 spot ID 1-1-4.1.17.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34562 [cLEG-31-F21] Trace: SGN-T69509 EST: SGN-E255216 Direction: 5' Facility: TIGR
Clone: SGN-C180703 [TUS-35-A21] Trace: SGN-T187369 EST: SGN-E375601 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375602Length: 215 bp (991 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375602 [] (trimmed) TTTTTTTTTACAACACAACTAGAATCGGTCAATTCACACAAATTGTTAATCATTGTTACAATATTGAGTTGATTTTGAACTTTTTCCGCTCAAAT
TTGAAGAAAATCAGAACACAAAGATGGAGAAAAGATTATTTTTCAGAAAATCAGAGAAATACAATTTACTATTTAGACATTTTCAAGCTGCATAA
AGAAACAACACAACAAAATCAACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375602] SGN-U579266 Tomato 200607 Build 2 55 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187370 [Download][View] Facility Assigned ID: FA0AAD23AA11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.848 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5