EST details — SGN-C180984
| Search information |
| Request: 180984 | Match: SGN-C180984 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C180984 | Clone name: TUS-35-M14 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C180984 is on microarray TOM1 spot ID 1-1-3.1.17.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C63467 [cLEM-25-L17] | Trace: SGN-T87735 | EST: SGN-E273020 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E392565 | Length: 100 bp (838 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E392565 [] (trimmed - flagged)
GCACGAGAATAAATAAACCCCCTTTCACTTATTTTCATTCAAGGACAAACTCTTTATAACTTTGTTATATGATATCACACAATTTTGTAGAATAA
AAATC
AAATC
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T193891 [Download][View] | Facility Assigned ID: FA0AAD23BG07RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.711 | Expected Error Rate: 0.0185 | Quality Trim Threshold: 14.5 |


