EST details — SGN-C180984

Search information 
Request: 180984Match: SGN-C180984
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C180984Clone name: TUS-35-M14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180984 is on microarray TOM1 spot ID 1-1-3.1.17.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C63467 [cLEM-25-L17] Trace: SGN-T87735 EST: SGN-E273020 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392565Length: 100 bp (838 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E392565 [] (trimmed - flagged) GCACGAGAATAAATAAACCCCCTTTCACTTATTTTCATTCAAGGACAAACTCTTTATAACTTTGTTATATGATATCACACAATTTTGTAGAATAA
AAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T193891 [Download][View] Facility Assigned ID: FA0AAD23BG07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.711 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5