EST details — SGN-C181580
| Search information |
| Request: 181580 | Match: SGN-C181580 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C181580 | Clone name: TUS-37-F10 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C181580 is on microarray TOM1 spot ID 1-1-7.2.12.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C145139 [cTOF-28-K7] | Trace: SGN-T160179 | EST: SGN-E346664 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C181580 [TUS-37-F10] | Trace: SGN-T194382 | EST: SGN-E393056 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393057 | Length: 95 bp (917 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393057 [] (trimmed - flagged)
GTTGGTAATTCAAAAGCCGAGCAAGTCCTAATCTTGAATGACGATGAGGGGAAGGAGGAAATCACTATCACTAAGAGGGCTCATCACCCTTTCTT
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T194383 [Download][View] | Facility Assigned ID: FA0AAD25DC05RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.906 | Expected Error Rate: 0.0043 | Quality Trim Threshold: 14.5 |
Working
