EST details — SGN-C181987
| Search information |
| Request: 181987 | Match: SGN-C181987 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C181987 | Clone name: TUS-38-G9 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C181987 is on microarray TOM1 spot ID 1-1-8.3.10.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C4408 [cLEC-25-H1] | Trace: SGN-T28671 | EST: SGN-E205255 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C181987 [TUS-38-G9] | Trace: SGN-T194527 | EST: SGN-E393201 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393202 | Length: 151 bp (963 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393202 [] (trimmed)
GTTCCGACAATTGACTTGTCGGATGACAAGTCTATTGCGTCCGAAATGATTGTGAAAGCATGTGAAGATTACGGTTTCTTTAAAGTTATAAATCA
CGGGGTTTCGAAGAAGGTGATCGCGAGAATGGAAAGGGAAGCCGCGGACTTCTTTT
CGGGGTTTCGAAGAAGGTGATCGCGAGAATGGAAAGGGAAGCCGCGGACTTCTTTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393202] | SGN-U568917 | Tomato 200607 | Build 2 | 19 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T194528 [Download][View] | Facility Assigned ID: FA0AAD26AD05RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.933 | Expected Error Rate: 0.0026 | Quality Trim Threshold: 14.5 |


