EST details — SGN-E182220

Search information 
Request: 182220Match: SGN-E182220
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123172Clone name: cTOB-9-J12
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C123172 [cTOB-9-J12] Trace: SGN-T131109 EST: SGN-E318739 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E182220Length: 355 bp (called/trimmed by facility)
Status: Legacy Direction: 5'
>SGN-E182220 [] (called/trimmed by facility)
TTCTCTCTTTTGTTGAACCCGAGTTCATCTTCTCAACAATGGCGCAAATTCCTCATATAGCAATTTTACCTTCTCCTGGTATGGGTCATTTAATC
CCTCTTGTCGAATTTGCTAAGAGAATTTTTCTCCATCATCACTTTTCTGTTTCTCTGATTCTCCCTACTGATGGCCCAATTTCTAACGCTCAGAA
AATTTTTCTGAACTCGCTTGCTTCTTCCATGGATTATCATCTTCTTCCTCCGGCTAATTTCGATGATTTACCTGAAGATGTTAAAATCGAGACTC
GAATTTCACTTACTGTTTCTCGTTCTCTTACTTCACTGCGTCAAGTTTTGGAATCTATTATTGAGTCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T131109 [Download][View] Facility Assigned ID: TFBBJ54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence