Notice: Due to a server restart, the site was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-C182247

Search information 
Request: 182247Match: SGN-C182247
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182247Clone name: TUS-39-B5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182247 is on microarray TOM1 spot ID 1-1-4.2.8.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C436 [cLEB-3-H14] Trace: SGN-T23144 EST: SGN-E203398 Direction: 5' Facility: TIGR
Clone: SGN-C436 [cLEB-3-H14] Trace: SGN-T23145 EST: SGN-E203399 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393956Length: 187 bp (993 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393956 [] (trimmed) GAAGAGTAACATGAAATGGAAAGAGGTGGTTCTGATGAAGAAGATGGAGAAACTTCTAGAAGGAAATTAAGGCTATCTTTTGACCAATCTGCCAT
TCTTGAAGAAAGTTTCAAAGAAGACAGCACACTCAATCCAAAACAAAAGCTGGCTTTGGCTAAAAAACTGGGATTGAGGGCGAGGGAAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393956] SGN-U573652 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195282 [Download][View] Facility Assigned ID: FA0AAD27CA03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0198 Quality Trim Threshold: 14.5