EST details — SGN-C182496

Search information 
Request: 182496Match: SGN-C182496
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182496Clone name: TUS-39-L14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182496 is on microarray TOM1 spot ID 1-1-3.4.8.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C96401 [cLEY-15-N18] Trace: SGN-T119656 EST: SGN-E307233 Direction: 5' Facility: TIGR
Clone: SGN-C182496 [TUS-39-L14] Trace: SGN-T191548 EST: SGN-E390222 Direction: 5' Facility: INRA
Clone: SGN-C182496 [TUS-39-L14] Trace: SGN-T191772 EST: SGN-E390446 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378607Length: 401 bp (1112 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378607 [] (trimmed) CTGCGGAATTCGGACACGAGAAGAGGAAGAGTCCAGTTGAAGTGAATAGAGAACAAAATTAACCGTCAAGTTACCTTCTCGAAACGTCGATCTGG
TTTGCTGAAGAAAGCCCATGAGATCTCTGTGCTTTGTGATGCTGAGGTTGGTTTGATTGTTTTTTCTACTAAAGGAAAACTCTTTGAATATGCCA
ACGATTCCTGCATGGAGAGGATACTTGAAAGATATGAAAGATACTCATTTGCTGAGAAACAGCTTGTTCCTACTGATCATACCTCCCCGGTAAGC
TGGACCCTTGAACATGCAAAACTTAAGGCCAGACTTGAGGTTCTGCAGAGGAACCAAAGCATTATGTGGGAGAAGATTTGGAGTCCTTAAGTATG
AAGGAACTTCAGAATCTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378607] SGN-U577950 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1727 [Download][View] Facility Assigned ID: TUS39L14.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5