EST details — SGN-C182603

Search information 
Request: 182603Match: SGN-C182603
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182603Clone name: TUS-40-A1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182603 is on microarray TOM1 spot ID 1-1-8.1.6.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C113100 [cTOA-1-E13] Trace: SGN-T124161 EST: SGN-E310238 Direction: 5' Facility: TIGR
Clone: SGN-C182603 [TUS-40-A1] Trace: SGN-T191561 EST: SGN-E390235 Direction: 5' Facility: INRA
Clone: SGN-C182603 [TUS-40-A1] Trace: SGN-T191782 EST: SGN-E390456 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378445Length: 452 bp (1407 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378445 [] (trimmed) TCCACGAGGCTATTGCAATTTTCATAGCTTTGGCCATATTTTTTCCTTTCACTTTTTGGTGCCTAAAATTGCTCTACTTTGTATGGTGGCGTCCG
AAAACAGTAGAAAATGAACTGCGTCATCAAGGAATCTATGGGCGTCCCTATAGATTTCTATTTGGAAATCTAAAAGAGATGATAGAGATGAACAA
AATAGCCAAATCTAAACCCATGCCATTGCACCACGATTTCACACCTCGACTTAATCCATTGTTCTATGAACTCGCTACCACTTACAAGAAACTTT
ACTTGTTTTGGCTAGGACCCATCCCTCGATTAACCATTTTGGATCCCAAGTTAATAAAGGAAGTACTGTCAAACAAATCTGGTGAGTTCAGAAAA
CCAAAAATCAGTGCTTTTCTGAAGCTATTTGTAACAGGGCTAGGGACTTACGATGGGGAAAAATGGGCCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378445] SGN-U567668 Tomato 200607 Build 2 66 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1737 [Download][View] Facility Assigned ID: TUS40A1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5