EST details — SGN-C182696

Search information 
Request: 182696Match: SGN-C182696
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182696Clone name: TUS-40-D22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182696 is on microarray TOM1 spot ID 1-1-3.4.5.6 [Order] [Tomato Microarray Database]
See unigene SGN-U578456 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C134058 [cTOD-7-O19] Trace: SGN-T143484 EST: SGN-E331789 Direction: 5' Facility: TIGR
Clone: SGN-C182696 [TUS-40-D22] Trace: SGN-T195920 EST: SGN-E394594 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394595Length: 200 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394595 [] (trimmed) GTTCTAAGTAGTTTATCTTCTCCAAATTTTATGATCAGATCTGTGTAGATCGTTGCTTGATCTACGTTTTGGATATGGATTTGCCGTGTTTCTGT
ACCGGACCGCCGTGGTTTTGTACCGGACCGGCGACTGACGGGCCGTATGGATGGATGGTTCGATATTTGTTTGTTCTGGCCCACGGTTGACGAAT
ATATGGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394595] SGN-U578456 Tomato 200607 Build 2 466 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195921 [Download][View] Facility Assigned ID: FA0AAD28DB11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5