EST details — SGN-C182745

Search information 
Request: 182745Match: SGN-C182745
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182745Clone name: TUS-40-F23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182745 is on microarray TOM1 spot ID 1-1-2.2.5.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C132309 [cTOD-2-E16] Trace: SGN-T141988 EST: SGN-E329374 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390531Length: 105 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390531 [] (trimmed) GAACAGGAATAAAGATAGTTGATATAAGTATACAGAAGCATCAAATTCTCATATATTAGTGTAGAAAATCCAATTCTCATAGAACAACAAAAAAG
AAAAAGTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390531] SGN-U581096 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191857 [Download][View] Facility Assigned ID: FA0AAD28CC12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.884 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5