EST details — SGN-C182824
| Search information |
| Request: 182824 | Match: SGN-C182824 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C182824 | Clone name: TUS-40-J6 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C182824 is on microarray TOM1 spot ID 1-1-3.2.6.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C134505 [cTOD-9-I22] | Trace: SGN-T144054 | EST: SGN-E331515 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C182824 [TUS-40-J6] | Trace: SGN-T196368 | EST: SGN-E395042 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E395043 | Length: 101 bp (917 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E395043 [] (trimmed)
TAGAAAAAATAAGAGAGCTTTTTTATCAATGGGTAATGCAGAGTATGATGAATATTCTTCTTCCTTGAAAGGAGAAAAAAACAGAAAAAAAGACC
AAGTTG
AAGTTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E395043] | SGN-U596377 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T196369 [Download][View] | Facility Assigned ID: FA0AAD28DE03RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.883 | Expected Error Rate: 0.0523 | Quality Trim Threshold: 14.5 |


