EST details — SGN-C182843

Search information 
Request: 182843Match: SGN-C182843
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182843Clone name: TUS-40-K1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182843 is on microarray TOM1 spot ID 1-1-8.3.6.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C112557 [cTOA-17-F9] Trace: SGN-T126481 EST: SGN-E313867 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390488Length: 224 bp (865 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390488 [] (trimmed) GGGCTTTTGCACTGAGGTTGAACATGTGATATCAATGAGTTTGACAGCTGTGAATTCCCTACTGGAGAAGTATTCTGTTGATCCGAAGCCAATTG
GTCGACTATAGGTTGGAAGTGAAGCTGTTAGTGAAAACATGCAATCCATCATGACATTCTTAATGGAAATATTTGAGAAGCCTGCAACTACTGAT
TTTGACCGAGATGACTCATCTCATGCCTGTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390488] SGN-U590676 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191814 [Download][View] Facility Assigned ID: FA0AAD28AF01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0354 Quality Trim Threshold: 14.5