EST details — SGN-C182988

Search information 
Request: 182988Match: SGN-C182988
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182988Clone name: TUS-41-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182988 is on microarray TOM1 spot ID 1-1-7.1.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11038 [cLEC-6-P24] Trace: SGN-T24068 EST: SGN-E202407 Direction: 5' Facility: TIGR
Clone: SGN-C182988 [TUS-41-A2] Trace: SGN-T191731 EST: SGN-E390405 Direction: 3' Facility: INRA
Clone: SGN-C182988 [TUS-41-A2] Trace: SGN-T191732 EST: SGN-E390406 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378217Length: 380 bp (1187 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378217 [] (trimmed) TCCACCAGAAACAAACGAACAATGGGTCCCATTCATTTCTGATGGACGCTAAGTTCGCCGGAAAGCCCATTCAGGCCCAATTTTATTCCGGTCAA
ACTAACCTCGAACAGATGCAGGATACTCCAACCCGCGGGGCACGCCACCGCCGTGCACAATCCGAAACCTTTTTCCGTTTTCCCAGTTTTGATGA
TGATATGCTTTTAGACGATGTCGTTTCTGACTTCAGTCTCGATGTTCAGGCTCCGACCCTCATGCAGCCGGCTAATTCGCCTGATTCTTCGTCTA
CTGGACCAGCGTTGTCGGCTGGACCTTCCGATTACCCTAAGCCGCTGGCTCACTACCGTAGTCTATCTGTTGATGCTGATTTTTTCGATGGACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378217] SGN-U579936 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1754 [Download][View] Facility Assigned ID: TUS41A2.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5