EST details — SGN-C183012

Search information 
Request: 183012Match: SGN-C183012
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183012Clone name: TUS-41-B2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183012 is on microarray TOM1 spot ID 1-1-7.2.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3600 [cLEC-21-C12] Trace: SGN-T28018 EST: SGN-E205695 Direction: 5' Facility: TIGR
Clone: SGN-C183012 [TUS-41-B2] Trace: SGN-T195641 EST: SGN-E394315 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398268Length: 349 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398268 [] (trimmed) CTGGTCAAATTCGCTTGGGGAATGTCTGTAGCAGGATAATGCACACCGATATAGGGCTCTAAATCTGATCTTTTACTCTCAGCCACTACCTCTCC
ATGTTCATCCTCATGAAATTTATATACCATAACCCTGTCATACCCGGTTAACTCCCTGACACTCTCAACAACAGTATCACACAAAAGCTTAATGT
CCCCACCAGGAAGTGATTGCAAATGAGAAATAGCCCTCACTGCAAGTTTCTGTGACTGCACGGCTCCAGCAATAGATAAAGCAGGGTCCTCAGTT
CTAGCAGGCTCCAAATCAATGACAATACCTACATCAACCCTGTGCAAAATTGCATAAAAGGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398268] SGN-U583481 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199594 [Download][View] Facility Assigned ID: FA0AAD29DA01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Vector found but pattern inconsistent with a normal insert
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5