EST details — SGN-C183515

Search information 
Request: 183515Match: SGN-C183515
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183515Clone name: TUS-42-G1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183515 is on microarray TOM1 spot ID 1-1-8.3.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82172 [cLET-1-C16] Trace: SGN-T102430 EST: SGN-E292156 Direction: 5' Facility: TIGR
Clone: SGN-C183515 [TUS-42-G1] Trace: SGN-T194931 EST: SGN-E393605 Direction: 3' Facility: INRA
Clone: SGN-C183515 [TUS-42-G1] Trace: SGN-T194931 EST: SGN-E399146 Direction: 3' Facility: INRA
Clone: SGN-C183515 [TUS-42-G1] Trace: SGN-T195483 EST: SGN-E394157 Direction: 3' Facility: INRA
Clone: SGN-C183515 [TUS-42-G1] Trace: SGN-T200239 EST: SGN-E399147 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394622Length: 291 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394622 [] (trimmed) CTGCCGTGTCGCCCCCTCCTAATCTGAAAGGCGCCTTGACAATCATTGATGAGAGGACCGGTAAGAAGTATCAGGTTCCGGTTACCGAGGAAGGA
ACTGTTAAAGCTACCGACTTTAAGAAAATATCTACTGGATACAATGATAAGGGTCTCAAGCTTTATGATCCGGGCTATCTCAACACTGCACCCGT
TCGTTCATCAATATGTTACATAGATGGTGATGCAGGGATTCTCAGGTATCGAGGTTACCCGATTGAGGAGTTGGCTGACAACAGTTTCATTCTTA
GAAGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394622] SGN-U573543 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195948 [Download][View] Facility Assigned ID: FA0AAD30AD01RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5