EST details — SGN-C183535
| Search information |
| Request: 183535 | Match: SGN-C183535 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C183535 | Clone name: TUS-42-G21 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183535 is on microarray TOM1 spot ID 1-1-4.3.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C6861 [cLEC-37-B14] | Trace: SGN-T31425 | EST: SGN-E208434 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183535 [TUS-42-G21] | Trace: SGN-T194936 | EST: SGN-E393610 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183535 [TUS-42-G21] | Trace: SGN-T194936 | EST: SGN-E399558 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183535 [TUS-42-G21] | Trace: SGN-T195489 | EST: SGN-E394163 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183535 [TUS-42-G21] | Trace: SGN-T195954 | EST: SGN-E399158 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393611 | Length: 161 bp (918 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393611 [] (trimmed)
GCTAATTTAGCTAGAGCAAAGCTCATTGTTGTCCTGACACGTGGCGGGAGTACAGCAAAGCTGGTTGCCAAGTATAGGCCTGCAGTTCCTATTCT
GTCAGTAGTCGTGCCTGTTTTGACTAGAGACTCTTTCGATTGGTCCATCGGGGCAAGACGCCCGCT
GTCAGTAGTCGTGCCTGTTTTGACTAGAGACTCTTTCGATTGGTCCATCGGGGCAAGACGCCCGCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393611] | SGN-U565588 | Tomato 200607 | Build 2 | 113 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T194937 [Download][View] | Facility Assigned ID: FA0AAD30AD11RM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.965 | Expected Error Rate: 0.0076 | Quality Trim Threshold: 14.5 |


