EST details — SGN-C183535

Search information 
Request: 183535Match: SGN-C183535
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183535Clone name: TUS-42-G21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183535 is on microarray TOM1 spot ID 1-1-4.3.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6861 [cLEC-37-B14] Trace: SGN-T31425 EST: SGN-E208434 Direction: 5' Facility: TIGR
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T194936 EST: SGN-E393610 Direction: 3' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T194936 EST: SGN-E399558 Direction: 3' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T195489 EST: SGN-E394163 Direction: 3' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T195954 EST: SGN-E399158 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393611Length: 161 bp (918 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393611 [] (trimmed) GCTAATTTAGCTAGAGCAAAGCTCATTGTTGTCCTGACACGTGGCGGGAGTACAGCAAAGCTGGTTGCCAAGTATAGGCCTGCAGTTCCTATTCT
GTCAGTAGTCGTGCCTGTTTTGACTAGAGACTCTTTCGATTGGTCCATCGGGGCAAGACGCCCGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393611] SGN-U565588 Tomato 200607 Build 2 113 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194937 [Download][View] Facility Assigned ID: FA0AAD30AD11RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5