Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C183573

Search information 
Request: 183573Match: SGN-C183573
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183573Clone name: TUS-42-I11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183573 is on microarray TOM1 spot ID 1-1-6.1.1.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1374 [cLEC-11-N20] Trace: SGN-T25647 EST: SGN-E201700 Direction: 5' Facility: TIGR
Clone: SGN-C183573 [TUS-42-I11] Trace: SGN-T195957 EST: SGN-E394631 Direction: 3' Facility: INRA
Clone: SGN-C183573 [TUS-42-I11] Trace: SGN-T200247 EST: SGN-E399167 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399168Length: 440 bp (966 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399168 [] (trimmed) GTGGAATTGACGCTGTTGTTTTGTACAGCCCGAAGATTTTTGAAAAAGCCGGGATCAAGTCCGATCACGACAAGTTGCTCTGCACCGTCGCCGTC
GGAGTAGTCAAAACATTGTTCATTCTAGTAGCCACATTTATGCTTGACAGATCCGGTCGTCGGCGGTTGCTATTAACCAGTGTCGGCGGAATGGT
GGCGTCGTTGGTGCTTCTCGCGACAGGCCTCACAATTATCGAACACTCAGAACAGAAATTAATTTGGGCAATAGCACTCTGCATAGCAATGGTGT
TAGCTTACGTGGCGCTTTTCTCAATCGGTATGGGTCCGATAACGTGGGTTTACAGTTCGGAGATATTTCCGTTGAGGCTCCGGGCAACTGGATGC
AGTATAGGGGTAGCAGTGAACAGAGTAACAAGTGGAGTAGTGTCAATGACTTTTTTGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399168] SGN-U565600 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200248 [Download][View] Facility Assigned ID: FA0AAD30AE06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5