EST details — SGN-C183593

Search information 
Request: 183593Match: SGN-C183593
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183593Clone name: TUS-42-J7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183593 is on microarray TOM1 spot ID 1-1-2.2.2.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34433 [cLEG-30-O1] Trace: SGN-T69041 EST: SGN-E255315 Direction: 5' Facility: TIGR
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T196092 EST: SGN-E394766 Direction: 3' Facility: INRA
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T196092 EST: SGN-E399394 Direction: 3' Facility: INRA
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T200369 EST: SGN-E399395 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394767Length: 267 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394767 [] (trimmed) GTTTTGAACCGACCCCTTTCTCTCTGTAGAGTCTCTCAACTCAGCGACGTCCGTTTTGATAAACTCAGAGACCCGGTTTCCATTTTCTCCACCTC
ACAAAATCAGGTAACATGGCGATCTTATTCCGAAGCTTCTCAGCCAACTCCGATAAATCCTCCACCACCACCTCCTCCATCCCCTAATACTTCTA
CAACAACTTCAAGTTCTCTCAATGAATTTGAACTTGCCGAATTCTCTGCCATTGCCGAAACCTGGAGGGATGCAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394767] SGN-U564286 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196093 [Download][View] Facility Assigned ID: FA0AAD30CE04RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5