EST details — SGN-C184026

Search information 
Request: 184026Match: SGN-C184026
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184026Clone name: TUS-43-L8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184026 is on microarray TOM1 spot ID 1-1-1.4.19.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22824 [cLED-3-J17] Trace: SGN-T49023 EST: SGN-E228375 Direction: 5' Facility: TIGR
Clone: SGN-C184026 [TUS-43-L8] Trace: SGN-T197972 EST: SGN-E396646 Direction: 5' Facility: INRA
Clone: SGN-C184026 [TUS-43-L8] Trace: SGN-T199950 EST: SGN-E398624 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378628Length: 318 bp (1101 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378628 [] (trimmed) TGTTAAAAAACTAGAAATTATGTCAAGCAGAGCGAAAGCAGATTTTGAGACTGAAGTTCGTCTTATCAGTAATGTCCATCATCGCAATCTCATCC
GTCTCTTGGGATGTTCAAACAAAGCATCAGACCTACTACTTGTTTACGAATACATGGCAAATGGCAGCCTCGAAAGATACTTATATGGAGACAGA
CGAGGGATGCTCAACTGGAAGCAAAGATTCAATATAATCTTTGGCACAGCTCGTGGCCTTGCATACTTGCACGAGCCAATCCCCGTCTGCATCAT
CCATCGAGATATAAAATCCAGCAACATTCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378628] SGN-U586568 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1808 [Download][View] Facility Assigned ID: TUS43L8.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0070 Quality Trim Threshold: 20.5