EST details — SGN-C184064

Search information 
Request: 184064Match: SGN-C184064
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184064Clone name: TUS-43-M22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184064 is on microarray TOM1 spot ID 1-1-3.1.18.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3903 [cLEC-22-M19] Trace: SGN-T28179 EST: SGN-E204015 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378729Length: 250 bp (1027 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378729 [] (trimmed) ACTCAAAGAAATAGAAAAATACAATTTAATTGGAATTGGACCATTGATTCCTTCATCATTCTTGGGTGGAAAAGATTCATTGGAATCTTCATTTG
GTGGTGATCTTTTTCAAAGTCAAATGATGACTACATGGAATGGTTAAACACAAAGCCTAAATCATCAATTGTTTATATCTCATTTGGGAGTCTAT
TGAATTTATCAAGAAACCAAAGGGAGGAGATTGCAAAAGGGTTGATAGAGATCCAAAGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378729] SGN-U578221 Tomato 200607 Build 2 135 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1809 [Download][View] Facility Assigned ID: TUS43M22.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.884 Expected Error Rate: 0.0022 Quality Trim Threshold: 20.5