EST details — SGN-C184066

Search information 
Request: 184066Match: SGN-C184066
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184066Clone name: TUS-43-M24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184066 is on microarray TOM1 spot ID 1-1-1.1.18.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3926 [cLEC-22-O7] Trace: SGN-T28118 EST: SGN-E203954 Direction: 5' Facility: TIGR
Clone: SGN-C184066 [TUS-43-M24] Trace: SGN-T197905 EST: SGN-E396579 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396580Length: 657 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396580 [] (trimmed) GTACAACTGAACAGTCTCCTGGATTCTGTTCAAGAAACAGAAACAAATATGGTGGAAATGTCTGCACTAAACCACCTTATGTCTACTCATGTTTT
GCAACAAGCCCAACAGATAGAGCTTTTATATGAGCAGGTTAGCAGTATTGTTGCTGTTTTACTTTCTAGTTGGATAGAGCTTCTATCTTGTTAAC
ATGACAAGTAAATCATTTTCTCTCTCTTTTTTTTAAAAACTAATTTAGACAATCTCTTCATTTCTTCTATTGACTTTGCAATTTGTAACTATTTC
CTAGTTAGAACTAACGAACATCACAATTCACGGATCTATGTGGTTATACTTTTATTAATTTGTTCTTTTAAAGCATTTAGAAGAATATCAAGCAT
TCGAAGTCCCTATATACCGCTTGAGTTTAATAATTGTCAGCTATCGACACACATGTATGACAATAAAAGAACACAGAAAGATTAAAAACAACGAT
GGAATACGTGTTTGTAGATGATCAATCAGGCTACATGTTTCTTTGAAGTGCACTGAACTGAATTCAGAATGATATTCTTCCATTGCCAGATACGA
AATGAGATTAAATGAAGAACCTGGGATTCATATAGTCGAACCCCAGCTTGTTTGGACTGAGGCGTAGTTGTTGTTATTCTTCCATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396580] SGN-U571275 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197906 [Download][View] Facility Assigned ID: FA0AAD31BG12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5