EST details — SGN-C184372

Search information 
Request: 184372Match: SGN-C184372
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184372Clone name: TUS-44-J18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184372 is on microarray TOM1 spot ID 1-1-7.2.16.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75682 [cLES-15-A19] Trace: SGN-T100845 EST: SGN-E287340 Direction: 5' Facility: TIGR
Clone: SGN-C184372 [TUS-44-J18] Trace: SGN-T199998 EST: SGN-E398672 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397088Length: 470 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397088 [] (trimmed) AAACTTCATCTTTAGTTCCAAGCTCCAATTTCACAAAAATGGGGAACCCTAAGAGACAATCCAATGATAGGAACGAAGAACTGCACGCGGCGGCT
CGATGTGGGGATCTTAACGCTGTTCAAACACTATGCAGCACCAATCCTTTAGCTGTCAACACTAGGGATAAACACTCTCGTACACCGCTCCATCT
AGCAGCATGGTCTGGCCATGCCCAGATTGTGGATTATCTCTGCAAAAACAAAGCTGATGTTGGGGCTGCTGCTATGGATGACATGGGTGCAATTC
ACTTTGCTGCTCAAAAAGGTCATTTAGAAGTTGTTAGGCTTCTTGTTAGTTCTGGAGTGTCTGTCAAATCATGCAACCGCAAGGGTATGACTGCC
CTTCATTATGCTGCCCAAGGGTCTCACCTAGAACTCGTCAAATATTTGCTGAAGAAAGGTTCTAATGTTAACACTAAAAACAAGGGCAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397088] SGN-U572992 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198414 [Download][View] Facility Assigned ID: FA0AAD32DE09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5