EST details — SGN-C184442
Search information |
Request: 184442 | Match: SGN-C184442 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C184442 | Clone name: TUS-44-M16 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184442 is on microarray TOM1 spot ID 1-1-1.1.16.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C21794 [cLED-35-D22] | Trace: SGN-T57708 | EST: SGN-E243934 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E396890 | Length: 85 bp (883 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E396890 [] (trimmed - flagged)
CTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCA
Unigenes |
Current Unigene builds | |||||
No current unigene builds incorporate this sequence |
Chromatogram |
SGN-ID: SGN-T198216 [Download][View] | Facility Assigned ID: FA0AAD32BG08RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Problems: | Possibly chimeric (anomalous insert into vector) |
Sequence Entropy: 0.990 | Expected Error Rate: 1.0000 | Quality Trim Threshold: 14.5 |