EST details — SGN-C184603

Search information 
Request: 184603Match: SGN-C184603
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184603Clone name: TUS-45-D9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184603 is on microarray TOM1 spot ID 1-1-8.4.14.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72032 [cLER-19-P14] Trace: SGN-T96519 EST: SGN-E284947 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397335Length: 325 bp (928 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397335 [] (trimmed) CATTTCTAATGTTTCATTTATTTTTCAAGCGTTCTTTACAGGTGCAAAGCACGTACAGGAAAAAAACCAAACCTAAAACAAACTCGAAAATCTAA
CCAAAACAAAACAAACACTAAAGGAAGTTTGAAAATTGCAAAAAATCGACTTAGTAAAAAGTGTTCCAGTCAAACCAGTTACCTTCACTGCCAAC
TCTAGGGATGCTATTAACTCTTGAATACATATCCACTTTGAAGTTGGCTCCACCCATTACCCCTTCATTATCTACCCGTGGCAAAGCCCTCATCT
GGTTCCTCGGGTGCTCGAAATGCTTTATTGCTGGGGCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397335] SGN-U570082 Tomato 200607 Build 2 66 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198661 [Download][View] Facility Assigned ID: FA0AAD33CB05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0142 Quality Trim Threshold: 14.5