EST details — SGN-C184661

Search information 
Request: 184661Match: SGN-C184661
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184661Clone name: TUS-45-F19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184661 is on microarray TOM1 spot ID 1-1-6.2.14.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78716 [cLES-6-I23] Trace: SGN-T98393 EST: SGN-E286941 Direction: 5' Facility: TIGR
Clone: SGN-C184661 [TUS-45-F19] Trace: SGN-T200042 EST: SGN-E398716 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397360Length: 156 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397360 [] (trimmed) GAACTACATACGTTCTTTTTCTTAAAGATGTTCCCGGGACCCATGAATTCCTCCTCCTTGACGAAGGAAAATGGGAACATGTTAAGGATACAACA
GAAATCGGAGAAGGAAAGATGTTCTCCCCTGGGAGTTGGAAGCCTCCATTGACTCTCCAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397360] SGN-U574431 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198686 [Download][View] Facility Assigned ID: FA0AAD33CC10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5