EST details — SGN-C184799

Search information 
Request: 184799Match: SGN-C184799
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184799Clone name: TUS-45-L13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184799 is on microarray TOM1 spot ID 1-1-4.4.14.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86490 [cLET-43-E6] Trace: SGN-T111137 EST: SGN-E299396 Direction: 5' Facility: TIGR
Clone: SGN-C184799 [TUS-45-L13] Trace: SGN-T198729 EST: SGN-E397403 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398723Length: 347 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398723 [] (trimmed) CAATAATTTAATTATACCATTTTAATTCCCATTTTGCCCTTTCTTCATGCAGACATAGCAATCTTTGGAACCGCAGGTTCAAGTTGACGTGGATT
CAAGTAAACTTTAAGTCCATTTTTCATAAACAAAGTCAACGACATTTTCTGTTCAACTTTATGACCGGGAACCGGTAATAGCCGGTACCGAAGCA
AAATAGCAGCAGCCACAGATTTCATTTGAAGGTAAGCCAAATCTTTTCCTAAACAAGTCCTCGGTCCACCATTAAATGCAACAAATTTATACCCA
TCTTTTGGCGGTTCGAACCGGTCTTTTTTTGTCGAGAGCCACCTCTCCGGTTTTGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398723] SGN-U574105 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200049 [Download][View] Facility Assigned ID: FA0AAD33CF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5