EST details — SGN-C184887

Search information 
Request: 184887Match: SGN-C184887
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184887Clone name: TUS-45-P5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184887 is on microarray TOM1 spot ID 1-1-4.4.14.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102243 [cLHT-24-D16] Trace: SGN-T170539 EST: SGN-E358979 Direction: 5' Facility: TIGR
Clone: SGN-C184887 [TUS-45-P5] Trace: SGN-T198750 EST: SGN-E397424 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397425Length: 497 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397425 [] (trimmed) GCTTATTCGGAAATTTTTTCTCTATCTGGGTTCCTTTTTCTACCGTCAAATACTCAATTGAACTAATTAGAAAACCATATATTCGGTTTATGTCT
CTTTCTATTCACTACCTCTTCATCATTTTCTAGCTTATTCTCTTTCTCTCTCTACAACTTTTTCTTCTTCTTCTGGGTTTTGATTACTTATTGCT
GGATTAAGAAATTTATCTTTAATTTGTATGTTTCTTTTGGTCAACTGCAAATTGAGGATCGATGTTTGATTACTTTAAATCGTTAAGCAATCCAA
AGACTGTGTTTTTTTTATCACTGGCCTTTGTTCCTGTTTAAAGGAGAGGCAAAATTTAATCTTTTGTGCTGGTGGCATTTGAGACCACAGCCAAT
GCAAGAATGATAGCGATGATTTCCTTTGATTTATTTATTAAATAAAAAAAGACACATCTTAAAAACGATTTAATATCCAATTATTTTATATTTTT
AGTCTCTAAATTTTCTAGCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397425] SGN-U588314 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198751 [Download][View] Facility Assigned ID: FA0AAD33CH03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0297 Quality Trim Threshold: 14.5