EST details — SGN-C185031

Search information 
Request: 185031Match: SGN-C185031
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185031Clone name: TUS-46-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185031 is on microarray TOM1 spot ID 1-1-4.2.12.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72202 [cLER-1-H20] Trace: SGN-T91989 EST: SGN-E280435 Direction: 5' Facility: TIGR
Clone: SGN-C185031 [TUS-46-F5] Trace: SGN-T199026 EST: SGN-E397700 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397701Length: 120 bp (905 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397701 [] (trimmed) GTCAAGTTCCATTAATTGCTTATTTACTCATCATCACATTCATTAGCGCTGTAGTTTTATTTTGTAATGCATCCTTCTTTAGGGGTTAGCAAAAG
GAAAATGGCTTTCTTTTCCCCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397701] SGN-U566445 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199027 [Download][View] Facility Assigned ID: FA0AAD34CC03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.788 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5