EST details — SGN-C185143

Search information 
Request: 185143Match: SGN-C185143
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185143Clone name: TUS-46-J21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185143 is on microarray TOM1 spot ID 1-1-4.2.11.2 [Order] [Tomato Microarray Database]
See unigene SGN-U572209 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C70520 [cLER-15-C1] Trace: SGN-T95107 EST: SGN-E282587 Direction: 5' Facility: TIGR
Clone: SGN-C185143 [TUS-46-J21] Trace: SGN-T199047 EST: SGN-E397721 Direction: 5' Facility: INRA
Clone: SGN-C185143 [TUS-46-J21] Trace: SGN-T199104 EST: SGN-E397778 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378644Length: 376 bp (973 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378644 [] (trimmed) TTTTAGGGCAAGATGTAGACACTGACAAGGATGGACGGATAAGTTCCGATGAATTCTCTACTATGATGAAGGCTGGAACAGATTGGAGGAAGGCA
TCAAGACAGTATTCACGAGAACGATATAATAGTCTCAGTTTGAAACTGATGAAGGATGGATCCTTACAAAGCTAATTAAGTAAAGCCAAAATATG
ACATCTTGAGTAAGTACTAGAACTCAGCTTTTGGCTTTCTAAATTCGTCCTTTCTTTCCTGTTCACCCATCGATCTGCCATTTTTTATTTCGTCT
CTGTATTTTTTCTTCTGAGGGTGGATCATTTAACTTGGGGACGACTGCAACATTCATGTGTTCTTTTGAGTTGTAATCAGGGTGTGTCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378644] SGN-U572209 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1874 [Download][View] Facility Assigned ID: TUS46J21.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5