EST details — SGN-C185402

Search information 
Request: 185402Match: SGN-C185402
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185402Clone name: TUS-47-E16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185402 is on microarray TOM1 spot ID 1-1-1.1.9.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71573 [cLER-18-G1] Trace: SGN-T96114 EST: SGN-E282318 Direction: 5' Facility: TIGR
Clone: SGN-C185402 [TUS-47-E16] Trace: SGN-T192180 EST: SGN-E390854 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390613Length: 380 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390613 [] (trimmed) TCTCTGTTATCGACTCCGTCACAGGTTTCGTTTCGATTACGGCGGCATCTCCATCACCATCATTTTCGTTTTCGTCTCTCACTGATTCAAATCTC
CCATTGGTTTACTGCGGTAGAGGTGATAAGAAGACGGCGAAAGGCAAGCGGTTCAATCACTCCTTTGGCAATGCAAGGCCAAGGAACAAGAAGAA
GGGAAGAGGACCACCTAGGGTTGCAGCACCACCAGCAGCACCAAAGAGAGATCCATTTGATGATGGCCAAGTCGTTAAAATTGAAATACATGACC
CATAGTTTTCTCGGAGGAGCAATTTCATTTTTATGTAGCTCTAATCTTCTACTACTTTGTTTATTTCATTGAAATATCGATTAAGTTAATCATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390613] SGN-U578318 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191939 [Download][View] Facility Assigned ID: FA0AAD35BC08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0240 Quality Trim Threshold: 14.5